Stem-loop sequence cpo-mir-505

AccessionMI0038805 (change log)
DescriptionCavia porcellus miR-505 stem-loop
Stem-loop
   --         g    a        ucug 
5'   gggagccag aagu uugauguu    c
     ||||||||| |||| ||||||||    c
3'   ccuuugguc uuca aacugcga    a
   cu         g    c        uuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562934.1: 2306789-2306847 [+]
intergenic
Database links

Mature sequence cpo-miR-505-5p

Accession MIMAT0047311
Sequence

1 - 

gggagccaggaaguauugauguu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-505-3p

Accession MIMAT0047312
Sequence

37 - 

cgucaacacuugcugguuuccuc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).