Stem-loop sequence cpo-mir-503

AccessionMI0038803 (change log)
DescriptionCavia porcellus miR-503 stem-loop
Stem-loop
   --ua                 g   u aggg 
5'     gcagcgggaacaguacu cag g    a
       ||||||||||||||||| ||| |    u
3'     cgucgucuuuguuguga guc c    u
   ggac                 g   u gugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2878959-2879021 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-503
cpo-mir-424DS562983.1: 2879319-2879377 [-]
cpo-mir-503DS562983.1: 2878959-2879021 [-]
cpo-mir-542DS562983.1: 2874159-2874217 [-]
cpo-mir-450a-2DS562983.1: 2873272-2873328 [-]
cpo-mir-450a-1DS562983.1: 2873102-2873159 [-]
cpo-mir-450bDS562983.1: 2872948-2873006 [-]
Database links

Mature sequence cpo-miR-503-5p

Accession MIMAT0047307
Sequence

1 - 

uagcagcgggaacaguacugcag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-503-3p

Accession MIMAT0047308
Sequence

41 - 

ggaguguuguuucugcugccagg

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).