Stem-loop sequence cpo-mir-501

AccessionMI0038801 (change log)
DescriptionCavia porcellus miR-501 stem-loop
Stem-loop
   --aau      uc    a u   -aa   uuu 
5'      ccuuug  ccug g gag   ugc   c
        ||||||  |||| | |||   |||   a
3'      gggaac  ggac c cuc   acg   g
   gucuu      --    - -   gug   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562987.1: 3009773-3009832 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-501
cpo-mir-532DS562987.1: 3003104-3003162 [+]
cpo-mir-188DS562987.1: 3003465-3003524 [+]
cpo-mir-500aDS562987.1: 3008302-3008367 [+]
cpo-mir-362DS562987.1: 3009085-3009144 [+]
cpo-mir-501DS562987.1: 3009773-3009832 [+]
cpo-mir-500bDS562987.1: 3010278-3010339 [+]
cpo-mir-660DS562987.1: 3012570-3012628 [+]
cpo-mir-502aDS562987.1: 3014248-3014306 [+]
Database links

Mature sequence cpo-miR-501-5p

Accession MIMAT0047303
Sequence

1 - 

aauccuuugucccugagugagaaugcu

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-501-3p

Accession MIMAT0047304
Sequence

38 - 

agugcucccaggcaaggguucug

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).