Stem-loop sequence cpo-mir-494

AccessionMI0038794 (change log)
DescriptionCavia porcellus miR-494 stem-loop
Stem-loop
   --     gu      -   c   -  uuu 
5'   agguu  ccgugu ugu uuc uc   a
     |||||  |||||| ||| ||| ||   u
3'   uccaa  ggcaca aca aag ag   u
   uc     ag      u   -   u  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1088359-1088414 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-494
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
Database links

Mature sequence cpo-miR-494-5p

Accession MIMAT0047289
Sequence

1 - 

agguuguccguguugucuucuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-494-3p

Accession MIMAT0047290
Sequence

34 - 

ugaaacauacacgggaaaccucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).