Stem-loop sequence cpo-mir-493

AccessionMI0038793 (change log)
DescriptionCavia porcellus miR-493 stem-loop
Stem-loop
   --uu                   ucacu     a 
5'     guacauaguaggcuuucau     cgugu c
       |||||||||||||||||||     |||||  
3'     cgugugucaucugggagug     gcaua u
   ggac                   -----     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 942145-942207 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-493
cpo-mir-493DS562966.1: 942145-942207 [+]
cpo-mir-337DS562966.1: 946840-946900 [+]
cpo-mir-431DS562966.1: 951653-951716 [+]
Database links

Mature sequence cpo-miR-493-5p

Accession MIMAT0047287
Sequence

1 - 

uuguacauaguaggcuuucauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-493-3p

Accession MIMAT0047288
Sequence

42 - 

ugagggucuacugugugccagg

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).