Stem-loop sequence cpo-mir-491

AccessionMI0038792 (change log)
DescriptionCavia porcellus miR-491 stem-loop
Stem-loop
   --  u      cc   c          a 
5'   ag ggggaa  cuu caugaggagu g
     || ||||||  ||| |||||||||| a
3'   uc ccccuu  gaa guauuccuca a
   cg  u      -a   u          c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562876.1: 452989-453044 [-]
intergenic
Database links

Mature sequence cpo-miR-491-5p

Accession MIMAT0047285
Sequence

1 - 

aguggggaacccuuccaugagga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-491-3p

Accession MIMAT0047286
Sequence

35 - 

cuuauguaagauuccccucugc

 - 56

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).