Stem-loop sequence cpo-mir-490

AccessionMI0038791 (change log)
DescriptionCavia porcellus miR-490 stem-loop
Stem-loop
   ---c      --         g   cacggu 
5'     caugga  ucuccaggu ggu      u
       ||||||  ||||||||| |||      a
3'     guaccu  ggaggucca cca      g
   uguc      ca         a   cauaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562865.1: 11766914-11766973 [-]
intergenic
Database links

Mature sequence cpo-miR-490-5p

Accession MIMAT0047283
Sequence

1 - 

ccauggaucuccaggugggu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-490-3p

Accession MIMAT0047284
Sequence

38 - 

caaccuggaggacuccaugcugu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).