Stem-loop sequence cpo-mir-486

AccessionMI0038788 (change log)
DescriptionCavia porcellus miR-486 stem-loop
   --                     ----   c uu 
5'   uccuguacugagcugccccga    ggc c  c
     |||||||||||||||||||||    ||| |   
3'   aggacaugacucgacggggcu    ccg g  c
   gu                     cgcc   u uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562935.1: 1296162-1296225 [+]
Database links

Mature sequence cpo-miR-486-5p

Accession MIMAT0047277

1 - 


 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-486-3p

Accession MIMAT0047278

43 - 


 - 64

Get sequence
Evidence experimental; Illumina [1]


PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).