Stem-loop sequence cpo-mir-483

AccessionMI0038786 (change log)
DescriptionCavia porcellus miR-483 stem-loop
Stem-loop
   --          aa   a  ---     g  u 
5'   aagacgggag  gag ag   ggagu gu a
     ||||||||||  ||| ||   ||||| ||  
3'   uucugcccuc  cuc uc   ccuca cg a
   ug          cc   c  acu     g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 12421632-12421692 [+]
intergenic
Database links

Mature sequence cpo-miR-483-5p

Accession MIMAT0047273
Sequence

1 - 

aagacgggagaagagaagggag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-483-3p

Accession MIMAT0047274
Sequence

40 - 

cacuccuccccucccgucuugu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).