Stem-loop sequence cpo-mir-455

AccessionMI0038785 (change log)
DescriptionCavia porcellus miR-455 stem-loop
Stem-loop
   --         u      a   c   gaa 
5'   uaugugccu uggacu cau gug   g
     ||||||||| |||||| ||| |||    
3'   auauacggg accuga gua cac   c
   ac         u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562857.1: 77905902-77905959 [-]
intergenic
Database links

Mature sequence cpo-miR-455-5p

Accession MIMAT0047271
Sequence

1 - 

uaugugccuuuggacuacaucg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-455-3p

Accession MIMAT0047272
Sequence

37 - 

augcaguccaugggcauauaca

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).