Stem-loop sequence cpo-mir-454

AccessionMI0038784 (change log)
DescriptionCavia porcellus miR-454 stem-loop
Stem-loop
   --       ---         ----   --u     a 
5'   acccuau   caauauugu    cuc   gcugu u
     |||||||   |||||||||    |||   |||||  
3'   ugggaua   guuauaacg    gag   cgaua a
   uu       uuc         ugau   ucu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 7083450-7083514 [-]
intergenic
Database links

Mature sequence cpo-miR-454-5p

Accession MIMAT0047269
Sequence

1 - 

acccuaucaauauugucucugcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-454-3p

Accession MIMAT0047270
Sequence

41 - 

uagugcaauauugcuuauaggguuu

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).