Stem-loop sequence cpo-mir-452

AccessionMI0038783 (change log)
DescriptionCavia porcellus miR-452 stem-loop
Stem-loop
   a   -g        g  a        uuug 
5'  acu  uuugcaga ga acugagac    c
    |||  |||||||| || ||||||||    a
3'  uga  aaacgucu cu ugacucug    a
   -   ag        a  c        uauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563052.1: 1057810-1057870 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-452
cpo-mir-452DS563052.1: 1057810-1057870 [-]
cpo-mir-224DS563052.1: 1056776-1056844 [-]
Database links

Mature sequence cpo-miR-452-5p

Accession MIMAT0047267
Sequence

1 - 

aacuguuugcagaggaaacugaga

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-452-3p

Accession MIMAT0047268
Sequence

40 - 

ucagucucaucugcaaagaagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).