Stem-loop sequence cpo-mir-450b

AccessionMI0038781 (change log)
DescriptionCavia porcellus miR-450b stem-loop
Stem-loop
   --uuu     u       ug     uaau 
5'      ugcaa auguucc  auaug    a
        ||||| |||||||  |||||    u
3'      acguu uacaagg  uauau    a
   uaccu     u       gu     gaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2872948-2873006 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-450b
cpo-mir-424DS562983.1: 2879319-2879377 [-]
cpo-mir-503DS562983.1: 2878959-2879021 [-]
cpo-mir-542DS562983.1: 2874159-2874217 [-]
cpo-mir-450a-2DS562983.1: 2873272-2873328 [-]
cpo-mir-450a-1DS562983.1: 2873102-2873159 [-]
cpo-mir-450bDS562983.1: 2872948-2873006 [-]
Database links

Mature sequence cpo-miR-450b-5p

Accession MIMAT0047264
Sequence

1 - 

uuuugcaauauguuccugauau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-450b-3p

Accession MIMAT0047265
Sequence

38 - 

auugggaacauuuugcauccau

 - 59

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).