Stem-loop sequence cpo-mir-449c

AccessionMI0038778 (change log)
DescriptionCavia porcellus miR-449c stem-loop
Stem-loop
   --   c      uu      u            u 
5'   agg agugca  gcuagc ggcuguuaagau u
     ||| ||||||  |||||| |||||||||||| u
3'   ucc ucacgu  ugaucg uugacgauuuua u
   uc   -      --      -            c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562884.1: 6899940-6900004 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-449c
cpo-mir-449cDS562884.1: 6899940-6900004 [+]
cpo-mir-449aDS562884.1: 6900585-6900645 [+]
Database links

Mature sequence cpo-miR-449c-5p

Accession MIMAT0047259
Sequence

1 - 

aggcagugcauugcuagcuggcuguu

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-449c-3p

Accession MIMAT0047260
Sequence

44 - 

caguugcuaguugcacuccucu

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).