Stem-loop sequence cpo-mir-449a

AccessionMI0038777 (change log)
DescriptionCavia porcellus miR-449a stem-loop
Stem-loop
   --       -    u        guug    u 
5'   uggcagu guau guuagcug    aaua a
     ||||||| |||| ||||||||    |||| u
3'   aucguca caua caaucgac    uuau a
   cu       a    -        --ga    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562884.1: 6900585-6900645 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-449a
cpo-mir-449cDS562884.1: 6899940-6900004 [+]
cpo-mir-449aDS562884.1: 6900585-6900645 [+]
Database links

Mature sequence cpo-miR-449a-5p

Accession MIMAT0047257
Sequence

1 - 

uggcaguguauuguuagcuggu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-449a-3p

Accession MIMAT0047258
Sequence

40 - 

cagcuaacauacaacugcuauc

 - 61

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).