Stem-loop sequence cpo-mir-448

AccessionMI0038776 (change log)
DescriptionCavia porcellus miR-448 stem-loop
Stem-loop
   --ga            g   u    - g aa       guc 
5'     acauccugcaug ugc gcca c a  ucccuuu   a
       |||||||||||| ||| |||| | |  |||||||   u
3'     uguaggauguac acg uggu g u  ggggaga   a
   accc            -   u    c g ca       auc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562901.1: 5141151-5141231 [-]
intergenic
Database links

Mature sequence cpo-miR-448-5p

Accession MIMAT0047255
Sequence

1 - 

gaacauccugcauggugcugcc

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-448-3p

Accession MIMAT0047256
Sequence

61 - 

uugcacauguaggauguccca

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).