Stem-loop sequence cpo-mir-433

AccessionMI0038775 (change log)
DescriptionCavia porcellus miR-433 stem-loop
Stem-loop
   --ua   u           u   --------  g     cu 
5'     cgg gagccugucau auu        ca agagg  a
       ||| ||||||||||| |||        || |||||   
3'     gcu cucggguagua uag        gu ucucc  g
   ugug   c           c   gaagaguu  g     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 952524-952597 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-433
cpo-mir-337DS562966.1: 946840-946900 [+]
cpo-mir-431DS562966.1: 951653-951716 [+]
cpo-mir-12073DS562966.1: 952329-952402 [+]
cpo-mir-433DS562966.1: 952524-952597 [+]
cpo-mir-127DS562966.1: 953628-953683 [+]
cpo-mir-432DS562966.1: 955129-955197 [+]
cpo-mir-136DS562966.1: 955349-955404 [+]
Database links

Mature sequence cpo-miR-433-5p

Accession MIMAT0047253
Sequence

1 - 

uacggugagccugucauuauuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-433-3p

Accession MIMAT0047254
Sequence

53 - 

aucaugaugggcuccucggugu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).