Stem-loop sequence cpo-mir-432

AccessionMI0038774 (change log)
DescriptionCavia porcellus miR-432 stem-loop
Stem-loop
   --ucu     ua       g     a   u uauu 
5'      uggag  ggucauu ggugg ucc c    u
        |||||  ||||||| ||||| ||| |    c
3'      accuc  ucgguag ucacc ggg g    c
   ucugu     -c       g     -   c uauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 955129-955197 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-432
cpo-mir-337DS562966.1: 946840-946900 [+]
cpo-mir-431DS562966.1: 951653-951716 [+]
cpo-mir-12073DS562966.1: 952329-952402 [+]
cpo-mir-433DS562966.1: 952524-952597 [+]
cpo-mir-127DS562966.1: 953628-953683 [+]
cpo-mir-432DS562966.1: 955129-955197 [+]
cpo-mir-136DS562966.1: 955349-955404 [+]
Database links

Mature sequence cpo-miR-432-5p

Accession MIMAT0047251
Sequence

1 - 

ucuuggaguaggucauugggugg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-432-3p

Accession MIMAT0047252
Sequence

48 - 

acuggauggcuccuccaugucu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).