Stem-loop sequence cpo-mir-431

AccessionMI0038773 (change log)
DescriptionCavia porcellus miR-431 stem-loop
Stem-loop
   --u          c  u a     ----   aca 
5'    gucuugcagg cg c ugcag    gcc   c
      |||||||||| || | |||||    |||    
3'    cgggacguuc gc g acguu    ugg   u
   cuu          u  u g     gcaa   cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 951653-951716 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-431
cpo-mir-493DS562966.1: 942145-942207 [+]
cpo-mir-337DS562966.1: 946840-946900 [+]
cpo-mir-431DS562966.1: 951653-951716 [+]
cpo-mir-12073DS562966.1: 952329-952402 [+]
cpo-mir-433DS562966.1: 952524-952597 [+]
cpo-mir-127DS562966.1: 953628-953683 [+]
cpo-mir-432DS562966.1: 955129-955197 [+]
cpo-mir-136DS562966.1: 955349-955404 [+]
Database links

Mature sequence cpo-miR-431-5p

Accession MIMAT0047249
Sequence

1 - 

ugucuugcaggccgucaugca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-431-3p

Accession MIMAT0047250
Sequence

44 - 

caggucgucuugcagggcuuc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).