Stem-loop sequence cpo-mir-429

AccessionMI0038772 (change log)
DescriptionCavia porcellus miR-429 stem-loop
Stem-loop
   ---  c          cg       cu   u 
5'    gu uuaccagaca  guuagau  gga g
      || ||||||||||  |||||||  |||  
3'    cg aauggucugu  uaaucug  ucu c
   ugc  u          ca       --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563041.1: 1148974-1149032 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-429
cpo-mir-200bDS563041.1: 1150409-1150467 [-]
cpo-mir-200aDS563041.1: 1149699-1149759 [-]
cpo-mir-429DS563041.1: 1148974-1149032 [-]
Database links

Mature sequence cpo-miR-429-5p

Accession MIMAT0047247
Sequence

1 - 

gucuuaccagacacgguuaga

 - 21

Get sequence
Evidence not experimental

Mature sequence cpo-miR-429-3p

Accession MIMAT0047248
Sequence

38 - 

uaauacugucugguaaugccgu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).