Stem-loop sequence cpo-mir-425

AccessionMI0038771 (change log)
DescriptionCavia porcellus miR-425 stem-loop
Stem-loop
   --aau       u  c     u  ----ag   g 
5'      gacacga ca ucccg ug      ugg c
        ||||||| || ||||| ||      |||  
3'      cugugcu gu agggc ac      acc a
   cccgc       -  a     u  cgaaga   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562863.1: 24185548-24185610 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-425
cpo-mir-191DS562863.1: 24185925-24185988 [-]
cpo-mir-425DS562863.1: 24185548-24185610 [-]
Database links

Mature sequence cpo-miR-425-5p

Accession MIMAT0047245
Sequence

1 - 

aaugacacgaucacucccguugag

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-425-3p

Accession MIMAT0047246
Sequence

42 - 

aucgggaaugucguguccgccc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).