Stem-loop sequence cpo-mir-424

AccessionMI0038770 (change log)
DescriptionCavia porcellus miR-424 stem-loop
Stem-loop
   --c      aa            --   au 
5'    agcagc  uucauguuuuga  agu  u
      ||||||  ||||||||||||  |||  c
3'    ucgucg  gagugcaaaacu  uca  u
   aua      cg            ug   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2879319-2879377 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-424
cpo-mir-424DS562983.1: 2879319-2879377 [-]
cpo-mir-503DS562983.1: 2878959-2879021 [-]
cpo-mir-542DS562983.1: 2874159-2874217 [-]
cpo-mir-450a-2DS562983.1: 2873272-2873328 [-]
cpo-mir-450a-1DS562983.1: 2873102-2873159 [-]
cpo-mir-450bDS562983.1: 2872948-2873006 [-]
Database links

Mature sequence cpo-miR-424-5p

Accession MIMAT0047243
Sequence

1 - 

cagcagcaauucauguuuugaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-424-3p

Accession MIMAT0047244
Sequence

38 - 

caaaacgugaggcgcugcuaua

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).