Stem-loop sequence cpo-mir-423

AccessionMI0038769 (change log)
DescriptionCavia porcellus miR-423 stem-loop
Stem-loop
   --        -ag   g    a     cua 
5'   ugaggggc   aga cgag cuuuu   u
     ||||||||   ||| |||| |||||   u
3'   acuccccg   ucu gcuc gaaaa   u
   ug        gag   g    -     ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 22509141-22509199 [-]
intergenic
Database links

Mature sequence cpo-miR-423-5p

Accession MIMAT0047241
Sequence

1 - 

ugaggggcagagagcgagacuuu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-423-3p

Accession MIMAT0047242
Sequence

37 - 

agcucggucugaggccccucagu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).