Stem-loop sequence cpo-mir-412

AccessionMI0038768 (change log)
DescriptionCavia porcellus miR-412 stem-loop
Stem-loop
   ---    c      u   aa    -    u 
5'    uggu gaccag ugg  agua auug c
      |||| |||||| |||  |||| ||||  
3'    auca cugguc acu  ucau uaau u
   ccg    c      c   --    g    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1117221-1117276 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-412
cpo-mir-134DS562966.1: 1107399-1107459 [+]
cpo-mir-485DS562966.1: 1108140-1108198 [+]
cpo-mir-154DS562966.1: 1112305-1112362 [+]
cpo-mir-496DS562966.1: 1113040-1113093 [+]
cpo-mir-377DS562966.1: 1114436-1114495 [+]
cpo-mir-541DS562966.1: 1116256-1116321 [+]
cpo-mir-409DS562966.1: 1117072-1117125 [+]
cpo-mir-412DS562966.1: 1117221-1117276 [+]
cpo-mir-369DS562966.1: 1117336-1117391 [+]
cpo-mir-410DS562966.1: 1117656-1117711 [+]
cpo-mir-323bDS562966.1: 1118056-1118114 [+]
cpo-mir-656DS562966.1: 1118353-1118408 [+]
Database links

Mature sequence cpo-miR-412-5p

Accession MIMAT0047239
Sequence

1 - 

uggucgaccaguuggaaaguaau

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-412-3p

Accession MIMAT0047240
Sequence

35 - 

uacuucaccugguccacuagcc

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).