Stem-loop sequence cpo-mir-411

AccessionMI0038767 (change log)
DescriptionCavia porcellus miR-411 stem-loop
Stem-loop
   --    a      a a       - uuu 
5'   uagu gaccgu u gcguacg c   a
     |||| |||||| | ||||||| |   u
3'   auca cuggca a uguaugc g   c
   ca    c      c a       a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1083271-1083326 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-411
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
Database links

Mature sequence cpo-miR-411-5p

Accession MIMAT0047237
Sequence

1 - 

uaguagaccguauagcguacg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-411-3p

Accession MIMAT0047238
Sequence

36 - 

uauguaacacgguccacuaac

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).