Stem-loop sequence cpo-mir-410

AccessionMI0038766 (change log)
DescriptionCavia porcellus miR-410 stem-loop
Stem-loop
   --    ug      a  a     - uuu 
5'   aggu  ucugug ug guucg c   a
     ||||  |||||| || ||||| |   u
3'   uccg  agacac au uaagc g   u
   ug    gu      a  a     a uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1117656-1117711 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-410
cpo-mir-485DS562966.1: 1108140-1108198 [+]
cpo-mir-154DS562966.1: 1112305-1112362 [+]
cpo-mir-496DS562966.1: 1113040-1113093 [+]
cpo-mir-377DS562966.1: 1114436-1114495 [+]
cpo-mir-541DS562966.1: 1116256-1116321 [+]
cpo-mir-409DS562966.1: 1117072-1117125 [+]
cpo-mir-412DS562966.1: 1117221-1117276 [+]
cpo-mir-369DS562966.1: 1117336-1117391 [+]
cpo-mir-410DS562966.1: 1117656-1117711 [+]
cpo-mir-323bDS562966.1: 1118056-1118114 [+]
cpo-mir-656DS562966.1: 1118353-1118408 [+]
Database links

Mature sequence cpo-miR-410-5p

Accession MIMAT0047235
Sequence

1 - 

agguugucugugaugaguucg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-410-3p

Accession MIMAT0047236
Sequence

36 - 

aauauaacacagauggccugu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).