Stem-loop sequence cpo-mir-409

AccessionMI0038765 (change log)
DescriptionCavia porcellus miR-409 stem-loop
Stem-loop
   --a    ac  a      -    cauc 
5'    gguu  cc agcaac uuug    u
      ||||  || |||||| ||||    g
3'    ccaa  gg ucguug aagc    a
   ucc    gu  c      u    aaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1117072-1117125 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-409
cpo-mir-134DS562966.1: 1107399-1107459 [+]
cpo-mir-485DS562966.1: 1108140-1108198 [+]
cpo-mir-154DS562966.1: 1112305-1112362 [+]
cpo-mir-496DS562966.1: 1113040-1113093 [+]
cpo-mir-377DS562966.1: 1114436-1114495 [+]
cpo-mir-541DS562966.1: 1116256-1116321 [+]
cpo-mir-409DS562966.1: 1117072-1117125 [+]
cpo-mir-412DS562966.1: 1117221-1117276 [+]
cpo-mir-369DS562966.1: 1117336-1117391 [+]
cpo-mir-410DS562966.1: 1117656-1117711 [+]
cpo-mir-323bDS562966.1: 1118056-1118114 [+]
cpo-mir-656DS562966.1: 1118353-1118408 [+]
Database links

Mature sequence cpo-miR-409-5p

Accession MIMAT0047233
Sequence

1 - 

agguuacccaagcaacuuugcaucu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-409-3p

Accession MIMAT0047234
Sequence

33 - 

gaauguugcucggugaaccccu

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).