Stem-loop sequence cpo-mir-383

AccessionMI0038763 (change log)
DescriptionCavia porcellus miR-383 stem-loop
Stem-loop
   --a      aa    a        uug   aga 
5'    gaucag  ggug uuguggcu   ggu   u
      ||||||  |||| ||||||||   |||    
3'    cugguc  ucac aacaccga   cua   a
   aga      cg    -        ---   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562891.1: 1425337-1425398 [-]
intergenic
Database links

Mature sequence cpo-miR-383-5p

Accession MIMAT0047229
Sequence

1 - 

agaucagaaggugauuguggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-383-3p

Accession MIMAT0047230
Sequence

42 - 

ccacaacacugccuggucaga

 - 62

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).