Stem-loop sequence cpo-mir-381

AccessionMI0038761 (change log)
DescriptionCavia porcellus miR-381 stem-loop
Literature search

1 open access papers mention cpo-mir-381
(2 sentences)

Stem-loop
   --  c   g        u        g cu  u 
5'   ag gag uugcccuu guauauuc g  ug u
     || ||| |||||||| |||||||| |  ||  
3'   uc cuc aacgggaa cauauaag c  ac g
   ug  u   g        -        g --  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1099199-1099261 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-381
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
cpo-mir-382DS562966.1: 1107038-1107096 [+]
cpo-mir-134DS562966.1: 1107399-1107459 [+]
cpo-mir-485DS562966.1: 1108140-1108198 [+]
Database links

Mature sequence cpo-miR-381-5p

Accession MIMAT0047225
Sequence

1 - 

agcgagguugcccuuuguauauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-381-3p

Accession MIMAT0047226
Sequence

42 - 

uauacaagggcaagcucucugu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).