Stem-loop sequence cpo-mir-380

AccessionMI0038760 (change log)
DescriptionCavia porcellus miR-380 stem-loop
Stem-loop
   -aug  u       ga       ---     
5'     gu gaccaua  acaugcg   cugg 
       || |||||||  |||||||   ||| c
3'     ca cugguau  uguaugc   gacu 
   ucug  c       aa       ugu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1084914-1084970 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-380
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
Database links

Mature sequence cpo-miR-380-5p

Accession MIMAT0047223
Sequence

1 - 

augguugaccauagaacaugcg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-380-3p

Accession MIMAT0047224
Sequence

37 - 

uauguaauaugguccacgucu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).