Stem-loop sequence cpo-mir-379

AccessionMI0038759 (change log)
DescriptionCavia porcellus miR-379 stem-loop
Stem-loop
   --    a       ga       -  uu u 
5'   uggu gacuaug  acguagg cg  a g
     |||| |||||||  ||||||| ||  |  
3'   auca cugguac  uguaucc gu  u a
   ca    c       aa       a  uu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1082082-1082140 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-379
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
Database links

Mature sequence cpo-miR-379-5p

Accession MIMAT0047221
Sequence

1 - 

ugguagacuauggaacguagg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-379-3p

Accession MIMAT0047222
Sequence

39 - 

uauguaacaugguccacuaac

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).