Stem-loop sequence cpo-mir-378

AccessionMI0038758 (change log)
DescriptionCavia porcellus miR-378 stem-loop
Literature search

1 open access papers mention cpo-mir-378
(3 sentences)

Stem-loop
   --  c              ugu      ccu 
5'   cu cugacuccaggucc   guguua   c
     || ||||||||||||||   ||||||    
3'   ga gacugagguucagg   cacgau   g
   cg  a              --u      aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562861.1: 11631876-11631935 [+]
intergenic
Database links

Mature sequence cpo-miR-378-5p

Accession MIMAT0047219
Sequence

1 - 

cuccugacuccagguccugugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-378-3p

Accession MIMAT0047220
Sequence

39 - 

acuggacuuggagucagaaggc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).