Stem-loop sequence cpo-mir-377

AccessionMI0038757 (change log)
DescriptionCavia porcellus miR-377 stem-loop
Stem-loop
   --          c   -    a    - uuu 
5'   agagguugcc uug guga uucg c   a
     |||||||||| ||| |||| |||| |   u
3'   uuuucaacgg aac cacu aagu g   g
   ug          a   a    -    u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1114436-1114495 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-377
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
cpo-mir-382DS562966.1: 1107038-1107096 [+]
cpo-mir-134DS562966.1: 1107399-1107459 [+]
cpo-mir-485DS562966.1: 1108140-1108198 [+]
cpo-mir-154DS562966.1: 1112305-1112362 [+]
cpo-mir-496DS562966.1: 1113040-1113093 [+]
cpo-mir-377DS562966.1: 1114436-1114495 [+]
cpo-mir-541DS562966.1: 1116256-1116321 [+]
cpo-mir-409DS562966.1: 1117072-1117125 [+]
cpo-mir-412DS562966.1: 1117221-1117276 [+]
cpo-mir-369DS562966.1: 1117336-1117391 [+]
cpo-mir-410DS562966.1: 1117656-1117711 [+]
cpo-mir-323bDS562966.1: 1118056-1118114 [+]
cpo-mir-656DS562966.1: 1118353-1118408 [+]
Database links

Mature sequence cpo-miR-377-5p

Accession MIMAT0047217
Sequence

1 - 

agagguugcccuuggugaauuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-377-3p

Accession MIMAT0047218
Sequence

39 - 

aucacacaaaggcaacuuuugu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).