Stem-loop sequence cpo-mir-376d

AccessionMI0038756 (change log)
DescriptionCavia porcellus miR-376d stem-loop
Stem-loop
   --           u c        ---u  a 
5'   guggauuuucc c uaugauua    gc u
     ||||||||||| | ||||||||    ||  
3'   caccuaaaagg g auacuaau    cg u
   ug           - c        uggu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1095388-1095445 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-376d
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
Database links

Mature sequence cpo-miR-376d-5p

Accession MIMAT0047215
Sequence

1 - 

guggauuuuccuccuaugauua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-376d-3p

Accession MIMAT0047216
Sequence

38 - 

aucauacgggaaaauccacgu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).