Stem-loop sequence cpo-mir-376c

AccessionMI0038755 (change log)
DescriptionCavia porcellus miR-376c stem-loop
Stem-loop
   --     ua      caa      ugu  u 
5'   gugga  uuccuu   uguuua   ca u
     |||||  ||||||   ||||||   ||  
3'   uaccu  aaggag   acaaau   gu u
   ug     ua      -ac      -ug  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1095062-1095119 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-376c
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
Database links

Mature sequence cpo-miR-376c-5p

Accession MIMAT0047213
Sequence

1 - 

guggauauuccuucaauguuua

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-376c-3p

Accession MIMAT0047214
Sequence

38 - 

aacacagaggaaauuccaugu

 - 58

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).