Stem-loop sequence cpo-mir-376a

AccessionMI0038753 (change log)
DescriptionCavia porcellus miR-376a stem-loop
Stem-loop
   --  a    c    u      --gua   u 
5'   gu gauu uccu cuauga     cau a
     || |||| |||| ||||||     ||| u
3'   ca cuaa agga gauacu     gua u
   ug  c    a    -      aauua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1096085-1096142 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-376a
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
Database links

Mature sequence cpo-miR-376a-5p

Accession MIMAT0047209
Sequence

1 - 

guagauucuccuucuaugagu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-376a-3p

Accession MIMAT0047210
Sequence

38 - 

aucauagaggaaaauccacgu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).