Stem-loop sequence cpo-mir-374

AccessionMI0038751 (change log)
DescriptionCavia porcellus miR-374 stem-loop
Stem-loop
   --           c   a       u 
5'   uuauaauacaa cug uaagugu a
     ||||||||||| ||| |||||||  
3'   aauguuauguu gac auucaca u
   uu           a   c       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562881.1: 22992971-22993022 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-374
cpo-mir-374DS562881.1: 22992971-22993022 [+]
cpo-mir-545DS562881.1: 22993124-22993185 [+]
Database links

Mature sequence cpo-miR-374-5p

Accession MIMAT0047205
Sequence

1 - 

uuauaauacaaccugauaagug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-374-3p

Accession MIMAT0047206
Sequence

31 - 

cuuaccagauuguauuguaauu

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).