Stem-loop sequence cpo-mir-290

AccessionMI0038750 (change log)
DescriptionCavia porcellus miR-290 stem-loop
Stem-loop
   --     -    u   g         uaau 
5'   acuca aacu cgg ggcacuuug    g
     ||||| |||| ||| |||||||||    u
3'   ugagu uugg guc ccgugaaau    g
   gg     c    -   g         ccag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562925.1: 3074407-3074465 [-]
intergenic
Database links

Mature sequence cpo-miR-290-5p

Accession MIMAT0047203
Sequence

1 - 

acucaaacuucgggggcacuuug

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-290-3p

Accession MIMAT0047204
Sequence

37 - 

aagugccgcuggguucugagugg

 - 59

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).