Stem-loop sequence cpo-mir-370

AccessionMI0038749 (change log)
DescriptionCavia porcellus miR-370 stem-loop
Stem-loop
   -      ca gu   u    u   a  g 
5'  ccaggu  c  cuc gcag uac ca c
    ||||||  |  ||| |||| ||| || u
3'  ggucca  g  ggg cguc gug gu c
   u      ag ug   u    c   a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 977812-977869 [+]
intergenic
Database links

Mature sequence cpo-miR-370-5p

Accession MIMAT0047201
Sequence

1 - 

ccaggucacgucucugcaguuac

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-370-3p

Accession MIMAT0047202
Sequence

37 - 

gccugcugggguggaaccuggu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).