Stem-loop sequence cpo-mir-367

AccessionMI0038747 (change log)
DescriptionCavia porcellus miR-367 stem-loop
Stem-loop
   --           u      c   -----  u 
5'   acuguugcuag gugcaa ucu     gc g
     ||||||||||| |||||| |||     || c
3'   ugguaacgauu cacguu agg     cg g
   ag           u      a   uccca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562898.1: 11471746-11471805 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-367
cpo-mir-302bDS562898.1: 11472221-11472282 [-]
cpo-mir-302cDS562898.1: 11472099-11472157 [-]
cpo-mir-302aDS562898.1: 11471972-11472035 [-]
cpo-mir-302dDS562898.1: 11471856-11471915 [-]
cpo-mir-367DS562898.1: 11471746-11471805 [-]
Database links

Mature sequence cpo-miR-367-5p

Accession MIMAT0047197
Sequence

1 - 

acuguugcuagugugcaacucu

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-367-3p

Accession MIMAT0047198
Sequence

39 - 

aauugcacuuuagcaaugguga

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).