Stem-loop sequence cpo-mir-363

AccessionMI0038744 (change log)
DescriptionCavia porcellus miR-363 stem-loop
Stem-loop
   --         ca  a         --ga   ga 
5'   cggguggau  cg ugcaauuuu    uua  c
     |||||||||  || |||||||||    |||   
3'   gucuaccua  gc acguuaaaa    gau  u
   au         ug  -         agag   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2512251-2512315 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-363
cpo-mir-106aDS562983.1: 2513060-2513118 [-]
cpo-mir-18bDS562983.1: 2512897-2512961 [-]
cpo-mir-20bDS562983.1: 2512676-2512744 [-]
cpo-mir-19b-2DS562983.1: 2512548-2512615 [-]
cpo-mir-92a-2DS562983.1: 2512411-2512471 [-]
cpo-mir-363DS562983.1: 2512251-2512315 [-]
Database links

Mature sequence cpo-miR-363-5p

Accession MIMAT0047192
Sequence

1 - 

cggguggaucacgaugcaauuuu

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-363-3p

Accession MIMAT0047193
Sequence

44 - 

aauugcacgguauccaucugua

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).