Stem-loop sequence cpo-mir-362

AccessionMI0038743 (change log)
DescriptionCavia porcellus miR-362 stem-loop
Stem-loop
   --          aacc        -a ug     
5'   aauccuuggg    uaggugug  g  cugc 
     ||||||||||    ||||||||  |  ||| u
3'   uuaggaacuu    auccacac  c  gacu 
   ac          ----        aa gu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562987.1: 3009085-3009144 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-362
cpo-mir-532DS562987.1: 3003104-3003162 [+]
cpo-mir-188DS562987.1: 3003465-3003524 [+]
cpo-mir-500aDS562987.1: 3008302-3008367 [+]
cpo-mir-362DS562987.1: 3009085-3009144 [+]
cpo-mir-501DS562987.1: 3009773-3009832 [+]
cpo-mir-500bDS562987.1: 3010278-3010339 [+]
cpo-mir-660DS562987.1: 3012570-3012628 [+]
cpo-mir-502aDS562987.1: 3014248-3014306 [+]
Database links

Mature sequence cpo-miR-362-5p

Accession MIMAT0047190
Sequence

1 - 

aauccuugggaaccuaggugugagug

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-362-3p

Accession MIMAT0047191
Sequence

39 - 

aacacaccuauucaaggauuca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).