Stem-loop sequence cpo-mir-361

AccessionMI0038742 (change log)
DescriptionCavia porcellus miR-361 stem-loop
Stem-loop
   --uu         --u  a    u    a  a 
5'     aucagaauc   cc gggg acuu ua u
       |||||||||   || |||| |||| || u
3'     uagucuuag   gg cccc ugaa au u
   cguu         ugu  a    c    a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562881.1: 13411983-13412045 [+]
intergenic
Database links

Mature sequence cpo-miR-361-5p

Accession MIMAT0047188
Sequence

1 - 

uuaucagaaucuccagggguac

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-361-3p

Accession MIMAT0047189
Sequence

40 - 

cccccaggugugauucugauuugc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).