Stem-loop sequence cpo-mir-350

AccessionMI0038741 (change log)
DescriptionCavia porcellus miR-350 stem-loop
Stem-loop
   --      cac c      -     gugag 
5'   aaagug   g gcuuug ggaca     g
     ||||||   | |||||| |||||     a
3'   uuucac   c cgaaac cuugu     a
   ac      aua c      a     aauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562868.1: 10177800-10177859 [-]
intergenic
Database links

Mature sequence cpo-miR-350-5p

Accession MIMAT0047186
Sequence

1 - 

aaagugcacgcgcuuugggaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-350-3p

Accession MIMAT0047187
Sequence

38 - 

uucacaaagcccauacacuuuca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).