Stem-loop sequence cpo-mir-346

AccessionMI0038740 (change log)
DescriptionCavia porcellus miR-346 stem-loop
Stem-loop
   --   cu    -  aug        u  guug 
5'   ugu  gccc gc   ccugccuc cu    c
     |||  |||| ||   |||||||| ||     
3'   acg  cggg cg   ggacggag ga    u
   cg   uc    u  --g        -  aguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562917.1: 5918308-5918367 [+]
intergenic
Database links

Mature sequence cpo-miR-346-5p

Accession MIMAT0047184
Sequence

1 - 

ugucugcccgcaugccugccucu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-346-3p

Accession MIMAT0047185
Sequence

39 - 

aggcaggggcugggccugcagc

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).