Stem-loop sequence cpo-mir-345

AccessionMI0038739 (change log)
DescriptionCavia porcellus miR-345 stem-loop
Stem-loop
   --gcu      c   c   u     u au 
5'      gacucc agu cag gcucg g  c
        |||||| ||| ||| ||||| |  c
3'      cugggg uca guc cgggc c  c
   gaggu      a   a   c     - ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 6113-6170 [+]
intergenic
Database links

Mature sequence cpo-miR-345-5p

Accession MIMAT0047182
Sequence

1 - 

gcugacucccaguccagugcu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-345-3p

Accession MIMAT0047183
Sequence

38 - 

cccugaacuaggggucuggag

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).