Stem-loop sequence cpo-mir-340

AccessionMI0038737 (change log)
DescriptionCavia porcellus miR-340 stem-loop
Stem-loop
   --        -caa      u    g    uug 
5'   uuauaaag    ugagac gauu ucau   u
     ||||||||    |||||| |||| ||||   c
3'   gauauuuc    acucug cuag ggug   u
   cc        auug      c    -    uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563031.1: 84280-84344 [+]
intergenic
Database links

Mature sequence cpo-miR-340-5p

Accession MIMAT0047178
Sequence

1 - 

uuauaaagcaaugagacugauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-340-3p

Accession MIMAT0047179
Sequence

43 - 

uccgucucaguuacuuuauagcc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).