Stem-loop sequence cpo-mir-339

AccessionMI0038736 (change log)
DescriptionCavia porcellus miR-339 stem-loop
Stem-loop
   --ucc     c  c   a       uau c 
5'      cuguc uc agg gcucacg   g c
        ||||| || ||| |||||||   |  
3'      gacag ag ucc cgagugu   c u
   gccga     u  c   g       --u g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562885.1: 12803260-12803317 [+]
intergenic
Database links

Mature sequence cpo-miR-339-5p

Accession MIMAT0047176
Sequence

1 - 

ucccuguccuccaggagcucacg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-339-3p

Accession MIMAT0047177
Sequence

36 - 

ugagcgccucgaugacagagccg

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).