Stem-loop sequence cpo-mir-338

AccessionMI0038735 (change log)
DescriptionCavia porcellus miR-338 stem-loop
Stem-loop
   --     u   -         agugaugac 
5'   aacaa auc cuggugcug         a
     ||||| ||| |||||||||          
3'   uuguu uag gacuacgac         c
   ag     u   u         cucaacgga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562931.1: 5706537-5706595 [-]
intergenic
Database links

Mature sequence cpo-miR-338-5p

Accession MIMAT0047174
Sequence

1 - 

aacaauauccuggugcugagu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-338-3p

Accession MIMAT0047175
Sequence

37 - 

uccagcaucagugauuuuguuga

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).