Stem-loop sequence cpo-mir-337

AccessionMI0038734 (change log)
DescriptionCavia porcellus miR-337 stem-loop
Stem-loop
   ---   c   u     c         u  ca 
5'    gaa ggc ucaua aggaguuga ug  c
      ||| ||| ||||| ||||||||| ||   
3'    cuu ccg aguau uccucgacu au  a
   cuc   u   u     a         u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 946840-946900 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-337
cpo-mir-493DS562966.1: 942145-942207 [+]
cpo-mir-337DS562966.1: 946840-946900 [+]
cpo-mir-431DS562966.1: 951653-951716 [+]
cpo-mir-12073DS562966.1: 952329-952402 [+]
cpo-mir-433DS562966.1: 952524-952597 [+]
cpo-mir-127DS562966.1: 953628-953683 [+]
cpo-mir-432DS562966.1: 955129-955197 [+]
cpo-mir-136DS562966.1: 955349-955404 [+]
Database links

Mature sequence cpo-miR-337-5p

Accession MIMAT0047172
Sequence

1 - 

gaacggcuucauacaggagu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-337-3p

Accession MIMAT0047173
Sequence

41 - 

uccuauaugaugccuuuccuc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).